julia- · August 29, 2015 14:16 · Feb 24, 2015 · Feb 24, 2015
diff --git a/gistfile1.md → readme.md b/gistfile1.md → readme.md
diff --git a/gistfile1.md b/gistfile1.md
@@ -0,0 +1,61 @@
+# Nucleotide Count
+
+DNA is represented by an alphabet of the following symbols: 'A', 'C', 'G', and 'T'.
+
+Each symbol represents a nucleotide, which is a fancy name for the particular molecules that happen to make up a large part of DNA.
+
+Shortest intro to biochemistry EVAR:
+
+* twigs are to birds nests as
+* nucleotides are to DNA and RNA as
+* amino acids are to proteins as
+* sugar is to starch as
+* oh crap lipids
+
+I'm not going to talk about lipids because they're crazy complex.
+
+So back to DNA.
+
+Write a class `DNA` that takes a DNA string. It should have two ways of telling us how many times each nucleotide occurs in the string: `#count(nucleotide)` and `#nucleotide_count`.
+
+```ruby
+dna = DNA.new("ATGCTTCAGAAAGGTCTTACG")
+
+dna.count('A')
+# => 6
+
+dna.count('T')
+# => 6
+
+dna.count('G')
+# => 5
+
+dna.count('C')
+# => 4
+
+dna.count('U') # Uracil is a nucleotide that is used in RNA
+# => 0
+
+dna.nucleotide_counts
+# => {'A' => 6, 'T' => 6, 'G' => 5, 'C' => 4}
+```
+
+The code should raise an argument error if you try to count something that isn't a nucleotide.
+
+```ruby
+dna.count('S')
+# dna.rb:23:in 'count': That's not a nucleotide, silly! (ArgumentError)
+```
+
+## Sample Dataset
+
+```ruby
+s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+dna = DNA.new(s)
+dna.nucleotide_counts
+# => {'A' => 20, 'T' => 21, 'G' => 17, 'C' => 12}
+```
+
+## Source
+The _Calculating DNA Nucleotides_ problem at [Rosalind](http://rosalind.info/problems/dna/)
+